October 2018 1 15 Report

kolejnosc nukleotydow w pewnej nici dna jest nastepujaca acttgcaaagcctatagaac dopisz nic komplementarna dna nic matrycowa dna jak sie je dopisuje o to chodzi w tym jak sie je tam laczy prosze krok po kroku


Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.