October 2018 1 13 Report

kolejnosc nukleotydow w pewnej nici dna jest nastepujaca acttgcaaagcctatagaac dopisz nic komplementarna dna nic matrycowa dna wiem ,że A-T G-C ale nie rozumiem czemu to jest tak porozpisywane takie dlugie jak sie to rozwiazuje by wyszlo takie wielkie wiazanie


Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.