December 2018 2 10 Report
Odczytaj zaszyfrowaną w mRNA kolejność aminokwasów budujących fragment kolagenu człowieka: AUGCUGCCACAAAUACCCUUUUUG
More Questions From This User See All

Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2025 KUDO.TIPS - All rights reserved.