September 2018 1 187 Report

Odczytaj zaszyfrowaną w DNA kolejność aminokwasów budujących jedno z białek w komórce drożdży GGCTTCTTGGGAGCAGGAAGCACTATGGGCGCA


More Questions From This User See All

Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.