October 2018 2 14 Report
Kolejnolsc nukleotydów w pewnej nici DNA jest nastepujaca ACTTGCAAAGCCTATAGAACT Do przedstawionej nici DNA dorysuj a) komplementarną nić DNA b) komplementarna nić RNA

Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.