August 2018 1 11 Report
Funkcja liniowa f(x)=(2-a)*x+3

Wyznacz liczbe dla której :
a) A=(-5,7) należy f(x)
b)f(x) jest funkcją rosnącą
c) wykres f(x) oraz g(x)= -0,75x+6 przecina oś oX w tym samym punkcie.


Prosze o szybką opowiedź
More Questions From This User See All
2√2 do kwadratu √2×√2 3-√3 przez 2×√2 2√3×3√2 3-2√4 przez √2 Poproszę o dokładne rozpisanie jak się takie rzeczy oblicza, bo mam z tym jakiś dziwny problem.
Answer
Połączenie szeregowe n=120 jednakowych kondensatorów o pojemności C=6nF. Oblicz pojemność zastępczą powstałej baterii
Answer
1.Wyjaśnij dlaczego czasteczki białek nazywamy makroczasteczkami. 2.W cytoplaźmie znajduje się mRNA o następującej sekwencji nukleotydów : AUGACAAAAGGUGGCUGGUUC a) zapisz sekwencję nukleotydów w dwuniciowym fragmencie DNA, na którym zaszedł proces transkrypcji podanego odcinka mRNA. b)podaj, z ilu aminokawsów będzie zbudowany łańcuch peptydowy, powstały w wyniku translacji tego fragmentu mRNA
Answer
Cross out the wrong form 1. I drink too/too much coffe 2. I eat too much/too many biscuits 3. I don't drink enugh water/ water enough 4. I can;t go. I'am too/too much busy 5. You wokr too much/too many 6. I only drink a few/ a little coffe 7.I don't have enough time/ time enough 8. He has a few/ a little good friends Complete the sentences with : too, too much, too many or enough 1 My father's not very fit. He doesn't do ................excercise 2 I can't walk to work. It's ...............far. 3 There are .................. cars on the roads today 4 I don't sleep ..................- only five or six hours, but I really need eight. 5 I was......................... tired to go out last night. 6 There were .................... people at the party, so it was impossible to dance.
Answer
Oblicz miejsce zerowe funkcji : F(X)=2x+5
Answer
Ask and answer . Ask for more information too. Every weekend /you normally have to work or study at the weekend? /there anything you always watch on TV /you normally have to buy anything on Saturdays? /have to do anything in the house (clean etc)? Last weekend /you go anywhere exciting on Friday night? /do anything tiring on Saturday morning? /you meet anybody on Saturday nigt? /you do anything relaxing on Sunday? Next weekend /you go away anywhere? /you do anything special on Saturday? /you go anywhere interesting on Sunday?
Answer
Complete with somebody, anything, nothing etc. 1. Are you doing.................tonight? 2........phoned when you were out. He said he'd call back later. 3I've seen your car keys............but I can't remember where. 4Did.................come while I was out? 5Did you go................. exciting last night? 6I've bought you...............for your birthday. 7I knocked at the door but............answered 8We went shopping but we didn't buy.................... b)Answer with nobody, nowhere o nothing 1.Wat did you do last nigth? 2.Where did you go yesterday? 3 Who did you see? Answer the question in b) with a full sentence 1 I didn't do................ 2 ............................... 3 .......................................
Answer
Complete the dilogues with the present or passive It's a very old film. It............. in 1942 ( made) Nowadays all bags............... at airports (check) This.............. by Picasso (paint) All the instructions .............in Japanese! (write) This door ........................... at night. It;s the emergency exit ( not lock) A man .................... by a shark yesterday (bite) When........the house............? (sell) This dress...................by Marilyn Monroe (wear) The pyramids ............. nearly 5,000 years ago ( build) I.............................. it for my birthday. (give) I forgot toturn my lights on and we .....................by the police (stop)
Answer
Complete the dialogues with the present simple or pst simple Since..............(be) five. I ...............(see) all the films many times. In fact I..........see dracula on DVD last week. A............you................ (ever be) to the UK? Yes, I ................do a language course in Oxford two years ago. Really? How long..............the course.........(last)? A month. I................(learn) a lot of English there. How long..........you............(know) Bill? We...........(be) friends for a long time. Fot more than twenty years. ..............you........(meet) at school? No, we..............(work) at the same restaurant in 1985 Where do your parents live? They ..........................(live) in paris since last year. But before that they .............(live) london. Why..............they..............(leave) London? Because my dad .................(retire) You look tired. How long ..................you................(be) at work today? Since eight o' clock this morning. .......................you........................(not go) for lunch with the others? No, I.............(not have) time. Is your sister married? Yes, she......................(be) married for ages. About ten years. She..........................(get) married when she was only 18
Answer
Order the words to make sentences : 1. named/ The sandwich/after/was/the Earl of Sandwich 2.designed/ Christopher Wren/ St Paul's Cathedral/was/by 3.based/This film/ a true story/is/on 4.published/ The first crossword puzzle/ in 1913/ was 5.the Diner's Club/ issued/ The first credit card/by/was 6.very often/ not used/ The fax machine/ these days/is discover/was/by/ Alexander Fleming/ Penicillin Write sentences in the present or passive 1What/your dog/call 2.Television/ invent/John Logie Baird 3.This room/ clean/ every morning 4.Her flat/ design/ a famous architect 5.Stamps/ only sell/ in the Post Office 6Where /thoes shoes/ make Rewritte the sentences in the passive 1Elton John sang Crocodile Rock Crocodile Rock........................ 2My cousin took all the photographs at our wedding All the photographs............................. 3A computer controls the heating The heating.................................. 4.Uruguay won the first World Cup The first World Cup......................... 5. Did Edison invent the telephone? Was........................................?
Answer

Recommend Questions

Na loterii jest 10 losów wygrywających i 20 losów przegrywających. Ile losówgrywających należy dodać, aby prawdopodobieństwo wygranej zmniejszyło się do 1/5 ? wiem ze to bedzie 20 ale nie wiem jakie obliczenia​
Pomocy! Zadanie 7!!! Na teraz
Poloncz równe ułamki
uzupełnij zdanie zamiast kropek wpisz większy lub mniejszy a) zaokrąglenie liczby 8,149 do części dziesiętnych jest......... od tej liczby b)zaokrąglenie liczby 284 do dziesiatek jest......... od tej liczby ​
BŁAGAM POMÓŻCIE PLIIIISSSSSSSS ❤️❤️❤️ DAJE ❤️ I NAJ!!!!!! BĘDĘ WDZIĘCZNA PLISSSSSSSSS...W tabeli (w załączniku) podano wyniki zakończonego sezonu szkolnej ligi piłkarskiej każda z drużyn rozegrała 10 meczów. Za wygrany mecz otrzymywała 3 punkty za remis 1 punkt a za porażkę 0 punktówWykonaj polecenie i napisz działanie Niebiescy w 10 meczach zdobyli 26 punktów. Ile razy odnieśli zwycięstwo A ile razy zremisowali​​
proszę o szybką pomoc!​
Oblicz DAJE NAJMatematyka PROSZĘ o szypka odpowiedź Na dzisiaj​
Zrobi ktoś ? prosze pilne na jutrro!!​
Oblicz i odpowiedź podaj w najprostszej postaci. Podaj dziedzinę. Bardzo proszę o szybką odpowiedź! Zad w załączniku
Proszę o rozwiązanie zadania nr 8

Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.