September 2018 1 30 Report

Do podanej sekwencji nici sensownej DNA dopisz sekwencję mRNA oraz polipeptydu, który powstanie w wyniku translacji tego mRNA. DNA:TACAAACCATGGGCGCAAGACAACGCTACCCGT mRNA: polipeptyd: ile w tym białku jest aminokwasów:


More Questions From This User See All

Recommend Questions



Life Enjoy

" Life is not a problem to be solved but a reality to be experienced! "

Get in touch

Social

© Copyright 2013 - 2024 KUDO.TIPS - All rights reserved.